Sample ID: LMJ1993
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:50:01 |
| Analysis completed | 2025-05-03 01:50:01 |
| Wall time | 0:0:0 hours |
Inconclusive
Outcome: The analyst should attempt subjective species identification at the genus level.
Reasoning: [Flag 1C] >3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | NA |
|
Inconclusive taxonomic identity (Flag 1C) Fungi. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
None
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis.
| Taxa of interest detected? | True |
|
Flag 2A: Taxon of interest detected in candidate species Flag 5.1NA: Assessment of related species is only possible for taxa at rank genus/species Flag 5.2NA: Assessment of related species is only possible for taxa at rank genus/species |
|
| Locus | ITS |
| Preliminary ID | Fungi |
| Taxa of interest |
Fungi |
| Country | Solomon Islands |
| Host | Musa |
| Sample ID | LMJ1993 |
| Query DNA sequence |
>LMJ1993 GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAAT GTAATAACTTCTATTGAAAGGTTCCAGAGTAGGCGCTACAACGCCGAAATGACCTTCTCA CCCTTGTGTACTCACTATGTTGCTTTGGCGGGTCGACCTGGTTCCGACCCAGGCGGCCGG CGCCCCCAGCCTTAACTGGCCAGGACGCCCGGCTAAGTGCCCGCCAGTATACAAAACTCA AGAATTCATTTTGTGAAGTCCTGATATATCATTTAATTGATTAAAACTTTCAACAACGGA TCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCA GAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGC ATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGGGCAACGTCCGCT GCCGGACGTGCCTTGAAGACCTCGGCGACGGCGTCCTAGCCTCGAGCGTAGTAGTAAAAT ATCTCGCTTTGGAGTGCTGGGCGACGGCCGCCGGACAATCGACCTTCGGTCTATTTTTCC AAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCA
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 500 | 50 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage |
|---|---|---|---|---|
| Phyllosticta capitalensis | 368 | 100.0% | 0.0 |
Database coverage of Candidate Phyllosticta capitalensisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Phyllosticta sp. | 33 | 100.0% | 0.0 |
Database coverage of Candidate Phyllosticta sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Botryosphaeria vaccinii | 12 | 100.0% | 0.0 |
Database coverage of Candidate Botryosphaeria vacciniiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| fungal endophyte sp. g46 | 1 | 100.0% | 0.0 |
Database coverage of Candidate fungal endophyte sp. g46This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| fungal endophyte | 14 | 100.0% | 0.0 |
Database coverage of Candidate fungal endophyteThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Phyllosticta musicola | 3 | 100.0% | 0.0 |
Database coverage of Candidate Phyllosticta musicolaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Phyllosticta fallopiae | 14 | 100.0% | 0.0 |
Database coverage of Candidate Phyllosticta fallopiaeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Phyllosticta paracapitalensis | 1 | 100.0% | 0.0 |
Database coverage of Candidate Phyllosticta paracapitalensisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. CGLA17 | 1 | 100.0% | 0.0 |
Database coverage of Candidate Guignardia sp. CGLA17This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| fungal endophyte sp. J30 | 1 | 100.0% | 0.0 |
Database coverage of Candidate fungal endophyte sp. J30This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. 102AM/L | 1 | 100.0% | 0.0 |
Database coverage of Candidate Guignardia sp. 102AM/LThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. 103PG/L | 1 | 100.0% | 0.0 |
Database coverage of Candidate Guignardia sp. 103PG/LThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Phyllosticta sp. MSR-1 | 1 | 100.0% | 0.0 |
Database coverage of Candidate Phyllosticta sp. MSR-1This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia musicola | 1 | 100.0% | 0.0 |
Database coverage of Candidate Guignardia musicolaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| fungal sp. | 2 | 100.0% | 0.0 |
Database coverage of Candidate fungal sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. 170GP/L | 1 | 100.0% | 0.0 |
Database coverage of Candidate Guignardia sp. 170GP/LThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. 162GP/S | 1 | 100.0% | 0.0 |
Database coverage of Candidate Guignardia sp. 162GP/SThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. ZJ8-7A | 1 | 100.0% | 0.0 |
Database coverage of Candidate Guignardia sp. ZJ8-7AThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. 112AC/S | 1 | 100.0% | 0.0 |
Database coverage of Candidate Guignardia sp. 112AC/SThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. | 4 | 100.0% | 0.0 |
Database coverage of Candidate Guignardia sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Phyllosticta philoprina | 1 | 100.0% | 0.0 |
Database coverage of Candidate Phyllosticta philoprinaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. MUCC0041 | 1 | 100.0% | 0.0 |
Database coverage of Candidate Guignardia sp. MUCC0041This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Phyllosticta sp. SAF-2022a | 5 | 100.0% | 0.0 |
Database coverage of Candidate Phyllosticta sp. SAF-2022aThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Diaporthe sp. SAF-2022a | 1 | 100.0% | 0.0 |
Database coverage of Candidate Diaporthe sp. SAF-2022aThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. Vega002 | 1 | 100.0% | 0.0 |
Database coverage of Candidate Guignardia sp. Vega002This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Phyllosticta sp. ZLY-2010 | 1 | 100.0% | 0.0 |
Database coverage of Candidate Phyllosticta sp. ZLY-2010This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Dothideomycetes sp. | 1 | 99.8% | 0.0 |
Database coverage of Candidate Dothideomycetes sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| fungal endophyte sp. g4 | 1 | 99.8% | 0.0 |
Database coverage of Candidate fungal endophyte sp. g4This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. Y3 | 1 | 99.8% | 0.0 |
Database coverage of Candidate Guignardia sp. Y3This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. 178PG/L | 1 | 99.8% | 0.0 |
Database coverage of Candidate Guignardia sp. 178PG/LThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. 127LD/L | 1 | 99.8% | 0.0 |
Database coverage of Candidate Guignardia sp. 127LD/LThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia camelliae | 4 | 99.8% | 0.0 |
Database coverage of Candidate Guignardia camelliaeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. EF11F02 | 1 | 99.8% | 0.0 |
Database coverage of Candidate Guignardia sp. EF11F02This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. 142HU/T | 1 | 99.8% | 0.0 |
Database coverage of Candidate Guignardia sp. 142HU/TThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| uncultured fungus | 2 | 99.8% | 0.0 |
Database coverage of Candidate uncultured fungusThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. GSM1_5_3 | 1 | 99.8% | 0.0 |
Database coverage of Candidate Guignardia sp. GSM1_5_3This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. SAF-2022a | 1 | 99.8% | 0.0 |
Database coverage of Candidate Guignardia sp. SAF-2022aThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Botryosphaeria sp. | 1 | 99.7% | 0.0 |
Database coverage of Candidate Botryosphaeria sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. SEGA49 | 1 | 99.7% | 0.0 |
Database coverage of Candidate Guignardia sp. SEGA49This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Phyllosticta rhizophorae | 1 | 99.7% | 0.0 |
Database coverage of Candidate Phyllosticta rhizophoraeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Diaporthe sp. | 1 | 99.7% | 0.0 |
Database coverage of Candidate Diaporthe sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. Fataf-10 | 1 | 99.7% | 0.0 |
Database coverage of Candidate Guignardia sp. Fataf-10This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nigrospora sp. | 1 | 99.7% | 0.0 |
Database coverage of Candidate Nigrospora sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. 110MC/L | 1 | 99.7% | 0.0 |
Database coverage of Candidate Guignardia sp. 110MC/LThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. GSM5_5_10 | 1 | 99.7% | 0.0 |
Database coverage of Candidate Guignardia sp. GSM5_5_10This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| fungal endophyte sp. g83 | 1 | 99.5% | 0.0 |
Database coverage of Candidate fungal endophyte sp. g83This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. 3GP/L | 1 | 99.5% | 0.0 |
Database coverage of Candidate Guignardia sp. 3GP/LThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Guignardia sp. GSL5_5_1 | 1 | 99.4% | 0.0 |
Database coverage of Candidate Guignardia sp. GSL5_5_1This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Phyllosticta sp. TACP00K40104 | 1 | 98.9% | 0.0 |
Database coverage of Candidate Phyllosticta sp. TACP00K40104This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Phyllosticta sp. TACP00K4021 | 1 | 98.9% | 0.0 |
Database coverage of Candidate Phyllosticta sp. TACP00K4021This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | OP897171 | Phyllosticta capitalensis isolate C_OH2206_31 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 2 | MT649663 | Phyllosticta sp. strain 97441 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 3 | MF380925 | Phyllosticta capitalensis strain MEF136 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 4 | OP897153 | Phyllosticta capitalensis isolate C_OH2208_4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 5 | EU167584 | Botryosphaeria vaccinii strain CBS 114751 small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 6 | EU273524 | Guignardia mangiferae isolate XSD-43 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 7 | MF993436 | Botryosphaeria vaccinii strain CRM-DLRZ4 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 8 | HM537040 | Fungal endophyte sp. g46 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 9 | LC542592 | Phyllosticta capitalensis MUCC 2935 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 10 | MT649658 | Phyllosticta sp. strain 95738 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 11 | LC719235 | Phyllosticta sp. AB-6-2 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 12 | JX436789 | Guignardia mangiferae strain C8b5 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 13 | KJ883595 | Phyllosticta capitalensis isolate MST 3-16 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 14 | EF419973 | Fungal endophyte isolate 9283 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 15 | MT649661 | Phyllosticta musicola strain 97073 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 16 | OP897190 | Phyllosticta fallopiae isolate P_OH248_4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 17 | OK584241 | Phyllosticta sp. strain CMRP4644 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 18 | JQ341114 | Guignardia mangiferae isolate D10b1b2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 19 | OK584257 | Phyllosticta sp. strain CMRP4660 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 20 | LC542591 | Phyllosticta capitalensis MUCC 2927 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 21 | OL957169 | Phyllosticta capitalensis strain CBS 128856 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 22 | OP897157 | Phyllosticta capitalensis isolate NP_OH1827_6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 23 | JQ341113 | Guignardia mangiferae isolate D12b3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1279.05 | 0.00e+00 | 100.0% |
| 24 | MF495391 | Phyllosticta capitalensis strain LCM 826.01 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1277.07 | 0.00e+00 | 100.0% |
| 25 | KF920711 | Guignardia mangiferae strain GZAAS6.1357 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.88S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 642 | 99.5% | 1273.1 | 0.00e+00 | 100.0% |
| 26 | MH183391 | Phyllosticta capitalensis strain VPRI41231 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1273.1 | 0.00e+00 | 100.0% |
| 27 | OK584120 | Phyllosticta sp. strain CMRP4507 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 641 | 99.4% | 1271.12 | 0.00e+00 | 100.0% |
| 28 | MT649668 | Phyllosticta capitalensis strain 101190 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 641 | 99.4% | 1271.12 | 0.00e+00 | 100.0% |
| 29 | AB041233 | Guignardia mangiferae genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, strain: IFO 33119 | 640 | 99.2% | 1269.14 | 0.00e+00 | 100.0% |
| 30 | OK584179 | Phyllosticta sp. strain CMRP4583 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 640 | 99.2% | 1269.14 | 0.00e+00 | 100.0% |
| 31 | KM979850 | Phyllosticta capitalensis strain F202 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 639 | 99.1% | 1267.16 | 0.00e+00 | 100.0% |
| 32 | KF435651 | Fungal endophyte culture-collection STRI:ICBG-Panama:TK469 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 638 | 98.9% | 1265.18 | 0.00e+00 | 100.0% |
| 33 | OQ793676 | Phyllosticta paracapitalensis strain BB001 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 638 | 98.9% | 1265.18 | 0.00e+00 | 100.0% |
| 34 | KM979800 | Phyllosticta capitalensis strain F211 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 638 | 98.9% | 1265.18 | 0.00e+00 | 100.0% |
| 35 | KM979840 | Phyllosticta capitalensis strain F187 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 637 | 98.8% | 1263.19 | 0.00e+00 | 100.0% |
| 36 | OL314496 | Phyllosticta elongata isolate SJD1-61-01 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 637 | 98.8% | 1263.19 | 0.00e+00 | 100.0% |
| 37 | OK584119 | Phyllosticta sp. strain CMRP4506 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 98.6% | 1261.21 | 0.00e+00 | 100.0% |
| 38 | JQ743587 | Phyllosticta capitalensis strain CBS 123373 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 635 | 98.4% | 1259.23 | 0.00e+00 | 100.0% |
| 39 | EU686803 | Fungal endophyte isolate 1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 635 | 98.4% | 1259.23 | 0.00e+00 | 100.0% |
| 40 | KR056285 | Phyllosticta capitalensis strain M161 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 635 | 98.4% | 1259.23 | 0.00e+00 | 100.0% |
| 41 | PQ577863 | Phyllosticta sp. strain MXJAL-514 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 635 | 98.4% | 1259.23 | 0.00e+00 | 100.0% |
| 42 | KF435717 | Fungal endophyte culture-collection STRI:ICBG-Panama:TK1672 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 635 | 98.4% | 1259.23 | 0.00e+00 | 100.0% |
| 43 | MF495420 | Botryosphaeria vaccinii strain LCM 886.01 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 635 | 98.4% | 1259.23 | 0.00e+00 | 100.0% |
| 44 | KF435727 | Fungal endophyte culture-collection STRI:ICBG-Panama:TK1761 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 635 | 98.4% | 1259.23 | 0.00e+00 | 100.0% |
| 45 | OQ172299 | Phyllosticta capitalensis isolate CATAS-DLJ1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1257.25 | 0.00e+00 | 100.0% |
| 46 | OQ172278 | Phyllosticta capitalensis isolate CATAS-FSJ10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1257.25 | 0.00e+00 | 100.0% |
| 47 | OQ172264 | Phyllosticta capitalensis isolate CATAS-RKJ11 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1257.25 | 0.00e+00 | 100.0% |
| 48 | OQ172275 | Phyllosticta capitalensis isolate CATAS-FSJ7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1257.25 | 0.00e+00 | 100.0% |
| 49 | OQ172265 | Phyllosticta capitalensis isolate CATAS-RKJ12 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1257.25 | 0.00e+00 | 100.0% |
| 50 | OR742009 | Phyllosticta capitalensis strain JFRL 03-2929 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 633 | 98.1% | 1255.26 | 0.00e+00 | 100.0% |
| 51 | PP514395 | Phyllosticta capitalensis isolate YL0 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 633 | 98.1% | 1255.26 | 0.00e+00 | 100.0% |
| 52 | EU821356 | Guignardia mangiferae isolate phy01 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 633 | 98.1% | 1255.26 | 0.00e+00 | 100.0% |
| 53 | OL957043 | Phyllosticta capitalensis isolate 15_SAT small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 633 | 98.1% | 1255.26 | 0.00e+00 | 100.0% |
| 54 | OL898551 | Phyllosticta capitalensis isolate 14_SAT small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 633 | 98.1% | 1255.26 | 0.00e+00 | 100.0% |
| 55 | PQ577862 | Phyllosticta sp. strain MXJAL-513 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 633 | 98.1% | 1255.26 | 0.00e+00 | 100.0% |
| 56 | HQ622105 | Guignardia sp. CGLA17 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 632 | 98.0% | 1253.28 | 0.00e+00 | 100.0% |
| 57 | LC542595 | Phyllosticta capitalensis MUCC 2916 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence | 632 | 98.0% | 1253.28 | 0.00e+00 | 100.0% |
| 58 | EU821358 | Guignardia mangiferae isolate phy03 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 631 | 97.8% | 1251.3 | 0.00e+00 | 100.0% |
| 59 | MF495383 | Phyllosticta capitalensis strain LCM 818.01 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 630 | 97.7% | 1249.32 | 0.00e+00 | 100.0% |
| 60 | JQ743585 | Phyllosticta capitalensis strain CPC 18122 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 630 | 97.7% | 1249.32 | 0.00e+00 | 100.0% |
| 61 | KU204436 | Phyllosticta capitalensis voucher INBio:112D 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 629 | 97.5% | 1247.34 | 0.00e+00 | 100.0% |
| 62 | FJ538333 | Guignardia mangiferae strain CBS 123404 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 628 | 97.4% | 1245.35 | 0.00e+00 | 100.0% |
| 63 | ON325542 | Phyllosticta capitalensis strain CMRP5048 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 627 | 97.2% | 1243.37 | 0.00e+00 | 100.0% |
| 64 | ON520745 | Phyllosticta sp. strain KUNCC22-10742 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 626 | 97.1% | 1241.39 | 0.00e+00 | 100.0% |
| 65 | ON325540 | Phyllosticta capitalensis strain CMRP4971 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 626 | 97.1% | 1241.39 | 0.00e+00 | 100.0% |
| 66 | GU066692 | Guignardia vaccinii isolate 130CL/L 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 623 | 96.6% | 1235.44 | 0.00e+00 | 100.0% |
| 67 | DQ480349 | Guignardia mangiferae isolate D9 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 623 | 96.6% | 1235.44 | 0.00e+00 | 100.0% |
| 68 | AM403717 | Guignardia mangiferae partial 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2 and partial 28S rRNA gene, strain WFCO008I | 622 | 96.4% | 1233.46 | 0.00e+00 | 100.0% |
| 69 | AY601899 | Fungal endophyte sp. J30 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 622 | 96.4% | 1233.46 | 0.00e+00 | 100.0% |
| 70 | OQ601535 | Phyllosticta capitalensis strain LSVM1089:EURL007 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 96.3% | 1231.48 | 0.00e+00 | 100.0% |
| 71 | MF663579 | Phyllosticta capitalensis strain LTL4_8 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 96.3% | 1231.48 | 0.00e+00 | 100.0% |
| 72 | OM571176 | Phyllosticta capitalensis strain SAUCC210148 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 96.3% | 1231.48 | 0.00e+00 | 100.0% |
| 73 | OM571175 | Phyllosticta capitalensis strain SAUCC210144 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 96.3% | 1231.48 | 0.00e+00 | 100.0% |
| 74 | GU066669 | Guignardia sp. 102AM/L 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 621 | 96.3% | 1231.48 | 0.00e+00 | 100.0% |
| 75 | PP599606 | Phyllosticta sp. strain BLA211 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 620 | 96.1% | 1229.5 | 0.00e+00 | 100.0% |
| 76 | KR056282 | Phyllosticta capitalensis strain M141 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 620 | 96.1% | 1229.5 | 0.00e+00 | 100.0% |
| 77 | GU066670 | Guignardia sp. 103PG/L 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 620 | 96.1% | 1229.5 | 0.00e+00 | 100.0% |
| 78 | JF441176 | Guignardia mangiferae strain RP22 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 619 | 96.0% | 1227.51 | 0.00e+00 | 100.0% |
| 79 | OQ217031 | Phyllosticta capitalensis strain CSED1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 619 | 96.0% | 1227.51 | 0.00e+00 | 100.0% |
| 80 | AF532314 | Phyllosticta sp. MSR-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 619 | 96.0% | 1227.51 | 0.00e+00 | 100.0% |
| 81 | NR_137716 | Guignardia musicola CBS 123405 ITS region; from TYPE material | 618 | 95.8% | 1225.53 | 0.00e+00 | 100.0% |
| 82 | OP872151 | Phyllosticta capitalensis strain CLW110 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 618 | 95.8% | 1225.53 | 0.00e+00 | 100.0% |
| 83 | OP872156 | Phyllosticta capitalensis strain CLW319 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 618 | 95.8% | 1225.53 | 0.00e+00 | 100.0% |
| 84 | OP872187 | Phyllosticta capitalensis strain CLW036 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 618 | 95.8% | 1225.53 | 0.00e+00 | 100.0% |
| 85 | PP599607 | Phyllosticta sp. strain BLA212 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 617 | 95.7% | 1223.55 | 0.00e+00 | 100.0% |
| 86 | OP872184 | Phyllosticta capitalensis strain CLW023 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1223.55 | 0.00e+00 | 100.0% |
| 87 | OP872183 | Phyllosticta capitalensis strain CLW016 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1223.55 | 0.00e+00 | 100.0% |
| 88 | KT289628 | Fungal sp. voucher Robert L. Gilbertson Mycological Herbarium 6731 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1223.55 | 0.00e+00 | 100.0% |
| 89 | AY277709 | Guignardia mangiferae strain 99_37 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 617 | 95.7% | 1223.55 | 0.00e+00 | 100.0% |
| 90 | OP872153 | Phyllosticta capitalensis strain CLW217 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1223.55 | 0.00e+00 | 100.0% |
| 91 | GQ352496 | Guignardia sp. 170GP/L 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 616 | 95.5% | 1221.57 | 0.00e+00 | 100.0% |
| 92 | GQ352495 | Guignardia sp. 162GP/S 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 616 | 95.5% | 1221.57 | 0.00e+00 | 100.0% |
| 93 | PP599615 | Phyllosticta sp. strain BLA258 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 616 | 95.5% | 1221.57 | 0.00e+00 | 100.0% |
| 94 | OP872167 | Phyllosticta capitalensis strain CLW013 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 615 | 95.3% | 1219.58 | 0.00e+00 | 100.0% |
| 95 | PP599583 | Phyllosticta sp. strain BLA165 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 615 | 95.3% | 1219.58 | 0.00e+00 | 100.0% |
| 96 | AY277708 | Guignardia mangiferae strain 99_32 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 615 | 95.3% | 1219.58 | 0.00e+00 | 100.0% |
| 97 | FJ037766 | Guignardia sp. ZJ8-7A 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 614 | 95.2% | 1217.6 | 0.00e+00 | 100.0% |
| 98 | ON325541 | Phyllosticta capitalensis strain CMRP4972 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 614 | 95.2% | 1217.6 | 0.00e+00 | 100.0% |
| 99 | OR675139 | Phyllosticta capitalensis isolate Q1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 614 | 95.2% | 1217.6 | 0.00e+00 | 100.0% |
| 100 | GU066677 | Guignardia sp. 112AC/S 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 613 | 95.0% | 1215.62 | 0.00e+00 | 100.0% |
| 101 | MK432976 | Guignardia sp. culture NTOU:4871 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 612 | 94.9% | 1213.64 | 0.00e+00 | 100.0% |
| 102 | OP872163 | Phyllosticta capitalensis strain CLW245 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 612 | 94.9% | 1213.64 | 0.00e+00 | 100.0% |
| 103 | PV030982 | Phyllosticta sp. isolate Camellia sinensis small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 611 | 94.7% | 1211.65 | 0.00e+00 | 100.0% |
| 104 | MH699964 | Phyllosticta capitalensis strain UPM-Ph1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 611 | 94.7% | 1211.65 | 0.00e+00 | 100.0% |
| 105 | KR016633 | Fungal endophyte isolate 6897 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 611 | 94.7% | 1211.65 | 0.00e+00 | 100.0% |
| 106 | OR131027 | Phyllosticta capitalensis isolate EF133 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 611 | 94.7% | 1211.65 | 0.00e+00 | 100.0% |
| 107 | OP163666 | Phyllosticta fallopiae isolate WZ-820 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 611 | 94.7% | 1211.65 | 0.00e+00 | 100.0% |
| 108 | KY828930 | Botryosphaeria vaccinii strain PBL4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 611 | 94.7% | 1211.65 | 0.00e+00 | 100.0% |
| 109 | OP872147 | Phyllosticta capitalensis strain CLW002 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 611 | 94.7% | 1211.65 | 0.00e+00 | 100.0% |
| 110 | ON076573 | Phyllosticta capitalensis strain JFRL-03-40 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 611 | 94.7% | 1211.65 | 0.00e+00 | 100.0% |
| 111 | KY765155 | Fungal endophyte strain SV1424 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 610 | 94.6% | 1209.67 | 0.00e+00 | 100.0% |
| 112 | LC269950 | Phyllosticta capitalensis genes for ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, isolate: ARAFAT-GF5 | 610 | 94.6% | 1209.67 | 0.00e+00 | 100.0% |
| 113 | KU663502 | Phyllosticta capitalensis strain Ae-26 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 610 | 94.6% | 1209.67 | 0.00e+00 | 100.0% |
| 114 | AB454332 | Guignardia mangiferae genes for ITS1, 5.8S rRNA, ITS2 and 28S rRNA, partial and complete sequence, isolate: MUCC0207 | 609 | 94.4% | 1207.69 | 0.00e+00 | 100.0% |
| 115 | KR015490 | Fungal endophyte isolate 3500 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 609 | 94.4% | 1207.69 | 0.00e+00 | 100.0% |
| 116 | KR015511 | Fungal endophyte isolate 3570 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 609 | 94.4% | 1207.69 | 0.00e+00 | 100.0% |
| 117 | AB454270 | Guignardia philoprina genes for ITS1, 5.8S rRNA, ITS2 and 28S rRNA, partial and complete sequence, isolate: MUCC0027 | 609 | 94.4% | 1207.69 | 0.00e+00 | 100.0% |
| 118 | AB454279 | Guignardia sp. MUCC0041 genes for ITS1, 5.8S rRNA, ITS2 and 28S rRNA, partial and complete sequence, isolate: MUCC0041 | 609 | 94.4% | 1207.69 | 0.00e+00 | 100.0% |
| 119 | AB454307 | Phyllosticta fallopiae genes for ITS1, 5.8S rRNA, ITS2 and 28S rRNA, partial and complete sequence, isolate: MUCC0113 | 609 | 94.4% | 1207.69 | 0.00e+00 | 100.0% |
| 120 | OP872178 | Phyllosticta capitalensis strain CLW097 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 609 | 94.4% | 1207.69 | 0.00e+00 | 100.0% |
| 121 | NR_147316 | Phyllosticta fallopiae MUCC 0113 ITS region; from TYPE material | 609 | 94.4% | 1207.69 | 0.00e+00 | 100.0% |
| 122 | OP163688 | Phyllosticta fallopiae isolate WZ-823 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 609 | 94.4% | 1207.69 | 0.00e+00 | 100.0% |
| 123 | AB731125 | Guignardia mangiferae genes for ITS1, 5.8S ribosomal RNA, ITS2, partial and complete sequence, isolate: MN144C54 | 609 | 94.4% | 1207.69 | 0.00e+00 | 100.0% |
| 124 | KR015859 | Fungal endophyte isolate 4718 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 609 | 94.4% | 1207.69 | 0.00e+00 | 100.0% |
| 125 | MT102324 | Phyllosticta capitalensis isolate Phc3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 608 | 94.3% | 1205.71 | 0.00e+00 | 100.0% |
| 126 | OP070537 | Phyllosticta sp. SAF-2022a isolate rigidus3_2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 608 | 94.3% | 1205.71 | 0.00e+00 | 100.0% |
| 127 | OP070547 | Diaporthe sp. SAF-2022a isolate faginius3_2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 608 | 94.3% | 1205.71 | 0.00e+00 | 100.0% |
| 128 | OP070507 | Phyllosticta sp. SAF-2022a isolate kerii3_1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 608 | 94.3% | 1205.71 | 0.00e+00 | 100.0% |
| 129 | MG265988 | Phyllosticta capitalensis voucher BCKSKMP-15 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 608 | 94.3% | 1205.71 | 0.00e+00 | 100.0% |
| 130 | EF694644 | Guignardia sp. Vega002 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence | 608 | 94.3% | 1205.71 | 0.00e+00 | 100.0% |
| 131 | KR016813 | Fungal endophyte isolate 7233 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 608 | 94.3% | 1205.71 | 0.00e+00 | 100.0% |
| 132 | OP070520 | Phyllosticta sp. SAF-2022a isolate borneensis3_1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 608 | 94.3% | 1205.71 | 0.00e+00 | 100.0% |
| 133 | PQ499435 | Phyllosticta sp. isolate YN1-2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 608 | 94.3% | 1205.71 | 0.00e+00 | 100.0% |
| 134 | OP070523 | Phyllosticta sp. SAF-2022a isolate palembanica2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 608 | 94.3% | 1205.71 | 0.00e+00 | 100.0% |
| 135 | HM595514 | Phyllosticta sp. ZLY-2010 isolate M13 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 608 | 94.3% | 1205.71 | 0.00e+00 | 100.0% |
| 136 | KP053393 | Phyllosticta capitalensis strain GH017 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 607 | 94.1% | 1203.73 | 0.00e+00 | 100.0% |
| 137 | OP070511 | Phyllosticta sp. SAF-2022a isolate coreaceus4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 607 | 94.1% | 1203.73 | 0.00e+00 | 100.0% |
| 138 | KU671305 | Phyllosticta capitalensis strain Fi-10 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 607 | 94.1% | 1203.73 | 0.00e+00 | 100.0% |
| 139 | MZ343487 | Phyllosticta sp. isolate I1L4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 140 | MW513426 | Phyllosticta capitalensis strain GZSN202005-1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 141 | MT649662 | Phyllosticta fallopiae strain 97422 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 142 | MW376494 | Phyllosticta capitalensis strain Yeh 0009 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 143 | MF076618 | Botryosphaeria vaccinii isolate S215 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 144 | PP830566 | Dothideomycetes sp. isolate SPL-70 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 145 | KC686597 | Guignardia mangiferae isolate MFUCC100138 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 146 | OP897212 | Phyllosticta fallopiae isolate P_OH2725_5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 147 | JN791606 | Guignardia mangiferae strain CGMCC3.14343 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 148 | MT186149 | Phyllosticta capitalensis isolate MFE23 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 149 | JN791605 | Guignardia mangiferae strain CGMCC3.14345 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 150 | HM537020 | Fungal endophyte sp. g4 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 151 | MG550984 | Phyllosticta capitalensis voucher R. Kirschner 4351 (TNM) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 152 | LC719234 | Phyllosticta sp. AB-1 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 153 | LC542594 | Phyllosticta capitalensis MUCC 2926 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 154 | MT649659 | Phyllosticta musicola strain 96000 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 155 | MT649664 | Phyllosticta sp. strain 97490 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.8% |
| 156 | OP872210 | Phyllosticta capitalensis strain CLW161 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 157 | OP872228 | Phyllosticta capitalensis strain CLW326 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 158 | MH141300 | Phyllosticta capitalensis strain Y.H. Yeh V0606 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1269.14 | 0.00e+00 | 99.8% |
| 159 | OP872174 | Phyllosticta capitalensis strain CLW366 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 160 | OP872201 | Phyllosticta capitalensis strain CLW113 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 161 | OP872192 | Phyllosticta capitalensis strain CLW074 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 162 | OP872180 | Phyllosticta capitalensis strain CLW353 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 163 | OP872168 | Phyllosticta capitalensis strain CLW042 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 164 | OQ793677 | Phyllosticta sp. strain M1434 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1269.14 | 0.00e+00 | 99.8% |
| 165 | OP872150 | Phyllosticta capitalensis strain CLW107 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 166 | OP872229 | Phyllosticta capitalensis strain CLW328 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 167 | MK336515 | Phyllosticta capitalensis strain Y. H. Yeh I1003 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1269.14 | 0.00e+00 | 99.8% |
| 168 | OP872216 | Phyllosticta capitalensis strain CLW202 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 169 | OP872173 | Phyllosticta capitalensis strain CLW268 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 170 | OP872234 | Phyllosticta capitalensis strain CLW352 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 171 | OP872218 | Phyllosticta capitalensis strain CLW260 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 172 | OP872159 | Phyllosticta capitalensis strain CLW369 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1269.14 | 0.00e+00 | 99.8% |
| 173 | OP872194 | Phyllosticta capitalensis strain CLW084 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1267.16 | 0.00e+00 | 99.8% |
| 174 | OP872226 | Phyllosticta capitalensis strain CLW323 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1267.16 | 0.00e+00 | 99.8% |
| 175 | OP872149 | Phyllosticta capitalensis strain CLW070 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1267.16 | 0.00e+00 | 99.8% |
| 176 | MH141232 | Phyllosticta capitalensis strain Y.H. Yeh V0106 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 643 | 99.7% | 1267.16 | 0.00e+00 | 99.8% |
| 177 | MK336530 | Phyllosticta capitalensis strain Y. H. Yeh I1107 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 643 | 99.7% | 1267.16 | 0.00e+00 | 99.8% |
| 178 | MH141245 | Phyllosticta capitalensis strain Y.H. Yeh V0203 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 643 | 99.7% | 1267.16 | 0.00e+00 | 99.8% |
| 179 | OP872152 | Phyllosticta capitalensis strain CLW116 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1267.16 | 0.00e+00 | 99.8% |
| 180 | MK336462 | Phyllosticta capitalensis strain Y. H. Yeh I0701 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 643 | 99.7% | 1267.16 | 0.00e+00 | 99.8% |
| 181 | OP872154 | Phyllosticta capitalensis strain CLW232 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1267.16 | 0.00e+00 | 99.8% |
| 182 | KF920708 | Guignardia mangiferae strain GZAAS6.1303 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.88S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 642 | 99.5% | 1265.18 | 0.00e+00 | 99.8% |
| 183 | KF920709 | Guignardia mangiferae strain GZAAS6.1306 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.88S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 642 | 99.5% | 1265.18 | 0.00e+00 | 99.8% |
| 184 | KF920712 | Guignardia mangiferae strain GZAAS6.1372 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.88S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 642 | 99.5% | 1265.18 | 0.00e+00 | 99.8% |
| 185 | MH183390 | Phyllosticta capitalensis strain VPRI14240 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1265.18 | 0.00e+00 | 99.8% |
| 186 | OP872166 | Phyllosticta capitalensis strain CLW193 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1263.19 | 0.00e+00 | 99.8% |
| 187 | KF920706 | Guignardia mangiferae strain GZAAS6.1238 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.88S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 641 | 99.4% | 1263.19 | 0.00e+00 | 99.8% |
| 188 | OP872222 | Phyllosticta capitalensis strain CLW285 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1263.19 | 0.00e+00 | 99.8% |
| 189 | OP872213 | Phyllosticta capitalensis strain CLW177 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1263.19 | 0.00e+00 | 99.8% |
| 190 | KF920707 | Guignardia mangiferae strain GZAAS6.1243 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.88S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 641 | 99.4% | 1263.19 | 0.00e+00 | 99.8% |
| 191 | KF920704 | Guignardia mangiferae strain GZAAS6.1103 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.88S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 641 | 99.4% | 1263.19 | 0.00e+00 | 99.8% |
| 192 | MK336610 | Phyllosticta capitalensis strain Y. H. Yeh I0103 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 641 | 99.4% | 1263.19 | 0.00e+00 | 99.8% |
| 193 | OP872162 | Phyllosticta capitalensis strain CLW401 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1263.19 | 0.00e+00 | 99.8% |
| 194 | AB041237 | Guignardia mangiferae genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, isolate: IOC-1242 | 640 | 99.2% | 1261.21 | 0.00e+00 | 99.8% |
| 195 | OP872172 | Phyllosticta capitalensis strain CLW190 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 641 | 99.4% | 1261.21 | 0.00e+00 | 99.8% |
| 196 | MK336497 | Phyllosticta capitalensis strain Y. H. Yeh I0907 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 640 | 99.2% | 1261.21 | 0.00e+00 | 99.8% |
| 197 | AB041236 | Guignardia mangiferae genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, strain:IFO 33122 | 640 | 99.2% | 1261.21 | 0.00e+00 | 99.8% |
| 198 | AB041240 | Guignardia mangiferae genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, strain: IFO 32914 | 640 | 99.2% | 1261.21 | 0.00e+00 | 99.8% |
| 199 | KF955291 | Guignardia mangiferae strain GZAAS6.1202 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 99.2% | 1261.21 | 0.00e+00 | 99.8% |
| 200 | KF920705 | Guignardia mangiferae strain GZAAS6.1221 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.88S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 639 | 99.1% | 1259.23 | 0.00e+00 | 99.8% |
| 201 | OP872186 | Phyllosticta capitalensis strain CLW032 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 640 | 99.2% | 1259.23 | 0.00e+00 | 99.8% |
| 202 | OP872158 | Phyllosticta capitalensis strain CLW078 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 640 | 99.2% | 1259.23 | 0.00e+00 | 99.8% |
| 203 | KM979852 | Phyllosticta capitalensis strain F75 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 639 | 99.1% | 1259.23 | 0.00e+00 | 99.8% |
| 204 | OP854672 | Phyllosticta capitalensis strain JFRL 03-249 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 637 | 98.8% | 1255.26 | 0.00e+00 | 99.8% |
| 205 | OP854674 | Phyllosticta capitalensis strain JFRL 03-251 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 637 | 98.8% | 1255.26 | 0.00e+00 | 99.8% |
| 206 | OP872202 | Phyllosticta capitalensis strain CLW128 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 637 | 98.8% | 1253.28 | 0.00e+00 | 99.8% |
| 207 | OP872179 | Phyllosticta capitalensis strain CLW248 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 637 | 98.8% | 1253.28 | 0.00e+00 | 99.8% |
| 208 | KM979885 | Phyllosticta capitalensis strain F210 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 636 | 98.6% | 1253.28 | 0.00e+00 | 99.8% |
| 209 | OP872148 | Phyllosticta capitalensis strain CLW038 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 98.6% | 1251.3 | 0.00e+00 | 99.8% |
| 210 | KP903462 | Guignardia sp. Y3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 635 | 98.4% | 1251.3 | 0.00e+00 | 99.8% |
| 211 | OP872227 | Phyllosticta capitalensis strain CLW324 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 98.6% | 1251.3 | 0.00e+00 | 99.8% |
| 212 | OP872185 | Phyllosticta capitalensis strain CLW030 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 98.6% | 1251.3 | 0.00e+00 | 99.8% |
| 213 | OQ172262 | Phyllosticta capitalensis isolate CATAS-RKJ9 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 214 | OQ172272 | Phyllosticta capitalensis isolate CATAS-FSJ4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 215 | OQ172288 | Phyllosticta capitalensis isolate CATAS-FSJ20 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 216 | OQ172255 | Phyllosticta capitalensis isolate CATAS-RKJ2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 217 | OQ172298 | Phyllosticta capitalensis isolate CATAS-MYJ1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 218 | EU821359 | Guignardia mangiferae isolate phy04 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 219 | OQ172256 | Phyllosticta capitalensis isolate CATAS-RKJ3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 220 | OQ172258 | Phyllosticta capitalensis isolate CATAS-RKJ5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 221 | OQ172254 | Phyllosticta capitalensis isolate CATAS-RKJ1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 222 | OQ172295 | Phyllosticta capitalensis isolate CATAS-WLJ1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 223 | OQ172268 | Phyllosticta capitalensis isolate CATAS-RKGJ4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 224 | OQ172287 | Phyllosticta capitalensis isolate CATAS-FSJ19 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 225 | OQ172289 | Phyllosticta capitalensis isolate CATAS-FSJ21 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 226 | OQ172266 | Phyllosticta capitalensis isolate CATAS-RKJ16 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 227 | OQ172292 | Phyllosticta capitalensis isolate CATAS-HMJ1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 228 | OQ172293 | Phyllosticta capitalensis isolate CATAS-LMJ1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 229 | OQ172277 | Phyllosticta capitalensis isolate CATAS-FSJ9 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 230 | OQ172286 | Phyllosticta capitalensis isolate CATAS-FSJ18 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 231 | OQ172296 | Phyllosticta capitalensis isolate CATAS-WLJ2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 232 | OQ172294 | Phyllosticta capitalensis isolate CATAS-LMJ2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 233 | OQ172283 | Phyllosticta capitalensis isolate CATAS-FSJ15 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 234 | OQ172270 | Phyllosticta capitalensis isolate CATAS-FSJ2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 235 | OQ172257 | Phyllosticta capitalensis isolate CATAS-RKJ4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 236 | OQ172260 | Phyllosticta capitalensis isolate CATAS-RKJ7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 237 | OQ172259 | Phyllosticta capitalensis isolate CATAS-RKJ6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 238 | OQ172284 | Phyllosticta capitalensis isolate CATAS-FSJ16 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 239 | OQ172263 | Phyllosticta capitalensis isolate CATAS-RKJ10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 240 | OQ172282 | Phyllosticta capitalensis isolate CATAS-FSJ14 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 241 | OQ172290 | Phyllosticta capitalensis isolate CATAS-FSJ22 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1249.32 | 0.00e+00 | 99.8% |
| 242 | OP872170 | Phyllosticta capitalensis strain CLW031 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1247.34 | 0.00e+00 | 99.8% |
| 243 | OP872197 | Phyllosticta capitalensis strain CLW102 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1247.34 | 0.00e+00 | 99.8% |
| 244 | EU821360 | Guignardia mangiferae isolate phy05 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 633 | 98.1% | 1247.34 | 0.00e+00 | 99.8% |
| 245 | LN828209 | Phyllosticta capitalensis genomic DNA sequence contains ITS1, 5.8S rRNA gene and ITS2, isolate BS5 | 633 | 98.1% | 1247.34 | 0.00e+00 | 99.8% |
| 246 | OR416472 | Phyllosticta fallopiae isolate GM283 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 633 | 98.1% | 1247.34 | 0.00e+00 | 99.8% |
| 247 | DQ480343 | Guignardia mangiferae isolate A5 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 633 | 98.1% | 1247.34 | 0.00e+00 | 99.8% |
| 248 | EU821357 | Guignardia mangiferae isolate phy02 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 631 | 97.8% | 1243.37 | 0.00e+00 | 99.8% |
| 249 | OP872177 | Phyllosticta capitalensis strain CLW008 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 631 | 97.8% | 1241.39 | 0.00e+00 | 99.8% |
| 250 | OP854673 | Phyllosticta capitalensis strain JFRL 03-250 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 630 | 97.7% | 1241.39 | 0.00e+00 | 99.8% |
| 251 | KU204594 | Phyllosticta capitalensis voucher INBio:558A 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 630 | 97.7% | 1241.39 | 0.00e+00 | 99.8% |
| 252 | KU204518 | Phyllosticta capitalensis voucher INBio:156D 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 629 | 97.5% | 1239.41 | 0.00e+00 | 99.8% |
| 253 | PQ721658 | Phyllosticta capitalensis isolate SICAUCC 24-0181 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 627 | 97.2% | 1235.44 | 0.00e+00 | 99.8% |
| 254 | DQ480348 | Guignardia mangiferae isolate D3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 627 | 97.2% | 1235.44 | 0.00e+00 | 99.8% |
| 255 | MN635748 | Phyllosticta capitalensis isolate SM20 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 96.7% | 1229.5 | 0.00e+00 | 99.8% |
| 256 | MH268061 | Phyllosticta sp. strain JHGB13_8A small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 96.7% | 1229.5 | 0.00e+00 | 99.8% |
| 257 | HM807531 | Guignardia mangiferae strain P2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 623 | 96.6% | 1227.51 | 0.00e+00 | 99.8% |
| 258 | MT043804 | Phyllosticta fallopiae isolate B3194 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1227.51 | 0.00e+00 | 99.8% |
| 259 | OP872214 | Phyllosticta capitalensis strain CLW186 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 624 | 96.7% | 1227.51 | 0.00e+00 | 99.8% |
| 260 | GU066723 | Guignardia sp. 178PG/L 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 623 | 96.6% | 1227.51 | 0.00e+00 | 99.8% |
| 261 | GU066689 | Guignardia sp. 127LD/L 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 623 | 96.6% | 1227.51 | 0.00e+00 | 99.8% |
| 262 | MN635751 | Phyllosticta capitalensis isolate SM37 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1227.51 | 0.00e+00 | 99.8% |
| 263 | GU066719 | Guignardia camelliae isolate 173CL/L 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 623 | 96.6% | 1227.51 | 0.00e+00 | 99.8% |
| 264 | OP962335 | Phyllosticta capitalensis isolate SAP-10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1227.51 | 0.00e+00 | 99.8% |
| 265 | KP743018 | Phyllosticta capitalensis strain YZ2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 266 | OP948162 | Phyllosticta capitalensis isolate RXT22 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 267 | OP948157 | Phyllosticta capitalensis isolate 52SCC2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 268 | JQ809680 | Guignardia sp. EF11F02 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 269 | OP948154 | Phyllosticta capitalensis isolate 32XGFBB11 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 270 | OP948161 | Phyllosticta capitalensis isolate LSY2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 271 | OP948159 | Phyllosticta capitalensis isolate LSCC111 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 272 | OL687395 | Phyllosticta capitalensis strain ZHKUCC 21-0107 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 273 | OP948152 | Phyllosticta capitalensis isolate 10WYDZS133 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 274 | OP948160 | Phyllosticta capitalensis isolate LSCC161 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 275 | OP948158 | Phyllosticta capitalensis isolate 91NCPH1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 276 | OP948163 | Phyllosticta capitalensis isolate 54SCE1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 277 | OP948156 | Phyllosticta capitalensis isolate 51SCA5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 278 | OP948151 | Phyllosticta capitalensis isolate 8DAMXY1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 279 | OP948155 | Phyllosticta capitalensis isolate 42SYA31 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 280 | FJ462743 | Guignardia camelliae isolate T120 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 281 | MW412580 | Phyllosticta capitalensis isolate CATAS-PC05 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 282 | OR800263 | Phyllosticta sp. isolate CB22-128 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 283 | OP948153 | Phyllosticta capitalensis isolate 11LSXTC72 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1225.53 | 0.00e+00 | 99.8% |
| 284 | GU066668 | Guignardia camelliae isolate 101CL/L 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 621 | 96.3% | 1223.55 | 0.00e+00 | 99.8% |
| 285 | OQ615949 | Phyllosticta capitalensis strain LSVM1166:EURL021 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 96.3% | 1223.55 | 0.00e+00 | 99.8% |
| 286 | GU066700 | Guignardia sp. 142HU/T 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 621 | 96.3% | 1223.55 | 0.00e+00 | 99.8% |
| 287 | KR093837 | Guignardia sp. isolate JSP 06 B 2.4 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 621 | 96.3% | 1223.55 | 0.00e+00 | 99.8% |
| 288 | OQ601575 | Phyllosticta capitalensis strain LSVM1104:EURL010 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 96.3% | 1223.55 | 0.00e+00 | 99.8% |
| 289 | OQ601559 | Phyllosticta capitalensis strain LSVM1119:EURL013 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 96.3% | 1223.55 | 0.00e+00 | 99.8% |
| 290 | AY816311 | Guignardia mangiferae voucher ICMP 8336 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 621 | 96.3% | 1223.55 | 0.00e+00 | 99.8% |
| 291 | FR863606 | Uncultured fungus 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene, clone 4Y2102-55 | 620 | 96.1% | 1221.57 | 0.00e+00 | 99.8% |
| 292 | MT470675 | Phyllosticta capitalensis strain HEV50K small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 620 | 96.1% | 1221.57 | 0.00e+00 | 99.8% |
| 293 | AY277717 | Guignardia mangiferae strain Rh_3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 620 | 96.1% | 1221.57 | 0.00e+00 | 99.8% |
| 294 | AY277716 | Guignardia mangiferae strain Rh_23a 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 619 | 96.0% | 1219.58 | 0.00e+00 | 99.8% |
| 295 | KF128847 | Guignardia sp. GSM1_5_3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 620 | 96.1% | 1219.58 | 0.00e+00 | 99.8% |
| 296 | FJ538322 | Guignardia mangiferae strain CBS 115046 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 618 | 95.8% | 1217.6 | 0.00e+00 | 99.8% |
| 297 | FJ538325 | Guignardia mangiferae strain CBS 115051 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 618 | 95.8% | 1217.6 | 0.00e+00 | 99.8% |
| 298 | AY277713 | Guignardia mangiferae strain 01_37 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 618 | 95.8% | 1217.6 | 0.00e+00 | 99.8% |
| 299 | FJ538327 | Guignardia mangiferae strain CBS 115053 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 618 | 95.8% | 1217.6 | 0.00e+00 | 99.8% |
| 300 | FJ538319 | Guignardia mangiferae strain CBS 101228 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 618 | 95.8% | 1217.6 | 0.00e+00 | 99.8% |
| 301 | FJ538336 | Guignardia mangiferae strain CBS 226.77 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 618 | 95.8% | 1217.6 | 0.00e+00 | 99.8% |
| 302 | FJ538339 | Phyllosticta capitalensis strain CBS 117118 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 618 | 95.8% | 1217.6 | 0.00e+00 | 99.8% |
| 303 | OP872358 | Phyllosticta capitalensis strain CLW058 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 618 | 95.8% | 1217.6 | 0.00e+00 | 99.8% |
| 304 | OP872334 | Phyllosticta capitalensis strain CLW025 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1215.62 | 0.00e+00 | 99.8% |
| 305 | OP872250 | Phyllosticta capitalensis strain CLW018 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1215.62 | 0.00e+00 | 99.8% |
| 306 | OP872383 | Phyllosticta capitalensis strain CLW261 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1215.62 | 0.00e+00 | 99.8% |
| 307 | FJ538346 | Guignardia mangiferae strain CMU 131 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 618 | 95.8% | 1215.62 | 0.00e+00 | 99.8% |
| 308 | MT649660 | Phyllosticta fallopiae strain 96446 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 617 | 95.7% | 1215.62 | 0.00e+00 | 99.8% |
| 309 | OP872276 | Phyllosticta capitalensis strain CLW022 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1215.62 | 0.00e+00 | 99.8% |
| 310 | OP872242 | Phyllosticta capitalensis strain CLW253 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1215.62 | 0.00e+00 | 99.8% |
| 311 | AY277714 | Guignardia mangiferae strain 01_40 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 617 | 95.7% | 1215.62 | 0.00e+00 | 99.8% |
| 312 | OP872275 | Phyllosticta capitalensis strain CLW021 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1215.62 | 0.00e+00 | 99.8% |
| 313 | MW512857 | Phyllosticta capitalensis isolate JQD-18-2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 616 | 95.5% | 1213.64 | 0.00e+00 | 99.8% |
| 314 | PP599597 | Phyllosticta sp. strain BLA195 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 616 | 95.5% | 1213.64 | 0.00e+00 | 99.8% |
| 315 | PP767340 | Phyllosticta musicola strain SAUCC 5563-2-1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 616 | 95.5% | 1213.64 | 0.00e+00 | 99.8% |
| 316 | AY277712 | Guignardia mangiferae strain 01_35 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 616 | 95.5% | 1213.64 | 0.00e+00 | 99.8% |
| 317 | OP070541 | Guignardia sp. SAF-2022a isolate eurynchus3_2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 616 | 95.5% | 1213.64 | 0.00e+00 | 99.8% |
| 318 | KR015441 | Fungal endophyte isolate 3339 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 616 | 95.5% | 1211.65 | 0.00e+00 | 99.8% |
| 319 | KR015491 | Fungal endophyte isolate 3501 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 616 | 95.5% | 1211.65 | 0.00e+00 | 99.8% |
| 320 | KY765153 | Fungal endophyte strain SV1420 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 616 | 95.5% | 1211.65 | 0.00e+00 | 99.8% |
| 321 | OP872254 | Phyllosticta capitalensis strain CLW010 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 615 | 95.3% | 1211.65 | 0.00e+00 | 99.8% |
| 322 | KF819611 | Guignardia mangiferae strain CR7 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 614 | 95.2% | 1209.67 | 0.00e+00 | 99.8% |
| 323 | JN979752 | Guignardia mangiferae strain BRIP 53721 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 613 | 95.0% | 1207.69 | 0.00e+00 | 99.8% |
| 324 | MK432977 | Guignardia sp. culture NTOU:4874 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 612 | 94.9% | 1205.71 | 0.00e+00 | 99.8% |
| 325 | LM994823 | Phyllosticta capitalensis genomic DNA containing 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene, strain GXBLS001 | 612 | 94.9% | 1205.71 | 0.00e+00 | 99.8% |
| 326 | OP872274 | Phyllosticta capitalensis strain CLW019 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 612 | 94.9% | 1205.71 | 0.00e+00 | 99.8% |
| 327 | MT259209 | Phyllosticta sp. isolate Hopea chinensis Hand.-Mazz. small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 611 | 94.7% | 1203.73 | 0.00e+00 | 99.8% |
| 328 | OP411031 | Phyllosticta fallopiae strain DN14 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 611 | 94.7% | 1203.73 | 0.00e+00 | 99.8% |
| 329 | MT658089 | Phyllosticta capitalensis strain BRPEL25 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 611 | 94.7% | 1203.73 | 0.00e+00 | 99.8% |
| 330 | MZ343496 | Phyllosticta sp. isolate I2L3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1271.12 | 0.00e+00 | 99.7% |
| 331 | LC542593 | Phyllosticta capitalensis MUCC 2930 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence | 645 | 100.0% | 1267.16 | 0.00e+00 | 99.7% |
| 332 | MT186144 | Phyllosticta capitalensis isolate MFE14 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1265.18 | 0.00e+00 | 99.7% |
| 333 | MW513430 | Phyllosticta capitalensis strain GZSN202005-5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1263.19 | 0.00e+00 | 99.7% |
| 334 | ON505961 | Phyllosticta sp. clone YB1609 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1263.19 | 0.00e+00 | 99.7% |
| 335 | MZ343534 | Botryosphaeria sp. isolate I7L1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1263.19 | 0.00e+00 | 99.7% |
| 336 | MZ343544 | Phyllosticta sp. isolate I8H2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1263.19 | 0.00e+00 | 99.7% |
| 337 | MK336554 | Phyllosticta capitalensis strain Y. H. Yeh I1206 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1263.19 | 0.00e+00 | 99.7% |
| 338 | MZ343532 | Phyllosticta sp. isolate I7H1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1263.19 | 0.00e+00 | 99.7% |
| 339 | OP872401 | Phyllosticta capitalensis strain CLW430 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 340 | OP872333 | Phyllosticta capitalensis strain CLW061 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 341 | OP872397 | Phyllosticta capitalensis strain CLW154 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 342 | OP872357 | Phyllosticta capitalensis strain CLW050 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 343 | OP872400 | Phyllosticta capitalensis strain CLW150 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 344 | OP872251 | Phyllosticta capitalensis strain CLW368 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 345 | OP872392 | Phyllosticta capitalensis strain CLW039 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 346 | OP872347 | Phyllosticta capitalensis strain CLW354 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 347 | OP872350 | Phyllosticta capitalensis strain CLW167 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 348 | OP872362 | Phyllosticta capitalensis strain CLW109 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 349 | OP872336 | Phyllosticta capitalensis strain CLW041 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 350 | OP872388 | Phyllosticta capitalensis strain CLW054 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 351 | OP872243 | Phyllosticta capitalensis strain CLW269 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 352 | OP872289 | Phyllosticta capitalensis strain CLW111 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 353 | OP872317 | Phyllosticta capitalensis strain CLW272 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 354 | OP872252 | Phyllosticta capitalensis strain CLW376 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 355 | OP872284 | Phyllosticta capitalensis strain CLW075 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 356 | OP872241 | Phyllosticta capitalensis strain CLW156 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 357 | OP872365 | Phyllosticta capitalensis strain CLW129 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 358 | OP872372 | Phyllosticta capitalensis strain CLW382 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 359 | OP872291 | Phyllosticta capitalensis strain CLW119 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 360 | OP872346 | Phyllosticta capitalensis strain CLW303 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.7% |
| 361 | OP872292 | Phyllosticta capitalensis strain CLW120 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1259.23 | 0.00e+00 | 99.7% |
| 362 | OP872353 | Phyllosticta capitalensis strain CLW387 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1259.23 | 0.00e+00 | 99.7% |
| 363 | OP872337 | Phyllosticta capitalensis strain CLW121 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1259.23 | 0.00e+00 | 99.7% |
| 364 | OP872340 | Phyllosticta capitalensis strain CLW404 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1259.23 | 0.00e+00 | 99.7% |
| 365 | OP872238 | Phyllosticta capitalensis strain CLW391 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1259.23 | 0.00e+00 | 99.7% |
| 366 | OP872262 | Phyllosticta capitalensis strain CLW403 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1259.23 | 0.00e+00 | 99.7% |
| 367 | OP872332 | Phyllosticta capitalensis strain CLW402 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1259.23 | 0.00e+00 | 99.7% |
| 368 | OP872399 | Phyllosticta capitalensis strain CLW087 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1259.23 | 0.00e+00 | 99.7% |
| 369 | MK336580 | Phyllosticta capitalensis strain Y. H. Yeh I0209 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 643 | 99.7% | 1259.23 | 0.00e+00 | 99.7% |
| 370 | OP872387 | Phyllosticta capitalensis strain CLW221 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1259.23 | 0.00e+00 | 99.7% |
| 371 | OP872278 | Phyllosticta capitalensis strain CLW026 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1259.23 | 0.00e+00 | 99.7% |
| 372 | OP872344 | Phyllosticta capitalensis strain CLW213 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 643 | 99.7% | 1257.25 | 0.00e+00 | 99.7% |
| 373 | OP872359 | Phyllosticta capitalensis strain CLW063 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 643 | 99.7% | 1257.25 | 0.00e+00 | 99.7% |
| 374 | OP872259 | Phyllosticta capitalensis strain CLW219 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 643 | 99.7% | 1257.25 | 0.00e+00 | 99.7% |
| 375 | OP872305 | Phyllosticta capitalensis strain CLW176 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1255.26 | 0.00e+00 | 99.7% |
| 376 | OP872307 | Phyllosticta capitalensis strain CLW184 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1255.26 | 0.00e+00 | 99.7% |
| 377 | OP872235 | Phyllosticta capitalensis strain CLW142 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1255.26 | 0.00e+00 | 99.7% |
| 378 | OP872385 | Phyllosticta capitalensis strain CLW288 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1255.26 | 0.00e+00 | 99.7% |
| 379 | OP872319 | Phyllosticta capitalensis strain CLW284 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1255.26 | 0.00e+00 | 99.7% |
| 380 | OP872335 | Phyllosticta capitalensis strain CLW034 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1255.26 | 0.00e+00 | 99.7% |
| 381 | OP872339 | Phyllosticta capitalensis strain CLW225 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1255.26 | 0.00e+00 | 99.7% |
| 382 | JN607105 | Guignardia sp. SEGA49 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 639 | 99.1% | 1251.3 | 0.00e+00 | 99.7% |
| 383 | OP872288 | Phyllosticta capitalensis strain CLW103 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 640 | 99.2% | 1251.3 | 0.00e+00 | 99.7% |
| 384 | OP872384 | Phyllosticta capitalensis strain CLW067 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 640 | 99.2% | 1251.3 | 0.00e+00 | 99.7% |
| 385 | OP872256 | Phyllosticta capitalensis strain CLW051 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 638 | 98.9% | 1247.34 | 0.00e+00 | 99.7% |
| 386 | OP872370 | Phyllosticta capitalensis strain CLW215 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 638 | 98.9% | 1247.34 | 0.00e+00 | 99.7% |
| 387 | OP872282 | Phyllosticta capitalensis strain CLW062 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 637 | 98.8% | 1245.35 | 0.00e+00 | 99.7% |
| 388 | OP872240 | Phyllosticta capitalensis strain CLW118 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 637 | 98.8% | 1245.35 | 0.00e+00 | 99.7% |
| 389 | OP872257 | Phyllosticta capitalensis strain CLW079 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 637 | 98.8% | 1245.35 | 0.00e+00 | 99.7% |
| 390 | MT360030 | Phyllosticta rhizophorae isolate NCYUCC 19-0352 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 635 | 98.4% | 1243.37 | 0.00e+00 | 99.7% |
| 391 | OP872393 | Phyllosticta capitalensis strain CLW101 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 98.6% | 1243.37 | 0.00e+00 | 99.7% |
| 392 | OP872273 | Phyllosticta capitalensis strain CLW015 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 98.6% | 1243.37 | 0.00e+00 | 99.7% |
| 393 | OP872283 | Phyllosticta capitalensis strain CLW066 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 636 | 98.6% | 1243.37 | 0.00e+00 | 99.7% |
| 394 | OQ172276 | Phyllosticta capitalensis isolate CATAS-FSJ8 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 395 | OQ172281 | Phyllosticta capitalensis isolate CATAS-FSJ13 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 396 | OQ172280 | Phyllosticta capitalensis isolate CATAS-FSJ12 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 397 | OQ172291 | Phyllosticta capitalensis isolate CATAS-FSS1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 398 | OQ172274 | Phyllosticta capitalensis isolate CATAS-FSJ6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 399 | MK045815 | Phyllosticta capitalensis strain LD small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 400 | MG661739 | Phyllosticta capitalensis isolate ISE041 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 401 | OQ172271 | Phyllosticta capitalensis isolate CATAS-FSJ3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 402 | OQ172269 | Phyllosticta capitalensis isolate CATAS-FSJ1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 403 | OQ172279 | Phyllosticta capitalensis isolate CATAS-FSJ11 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 404 | OQ172297 | Phyllosticta capitalensis isolate CATAS-WLJ3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 405 | OQ172273 | Phyllosticta capitalensis isolate CATAS-FSJ5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 406 | OQ172261 | Phyllosticta capitalensis isolate CATAS-RKGJ8 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1241.39 | 0.00e+00 | 99.7% |
| 407 | OP872295 | Phyllosticta capitalensis strain CLW132 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1239.41 | 0.00e+00 | 99.7% |
| 408 | OQ172267 | Phyllosticta capitalensis isolate CATAS-RKGJ2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1239.41 | 0.00e+00 | 99.7% |
| 409 | MZ343522 | Diaporthe sp. isolate I6H1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 633 | 98.1% | 1239.41 | 0.00e+00 | 99.7% |
| 410 | OP872236 | Phyllosticta capitalensis strain CLW243 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 633 | 98.1% | 1237.42 | 0.00e+00 | 99.7% |
| 411 | OP872255 | Phyllosticta capitalensis strain CLW001 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 631 | 97.8% | 1233.46 | 0.00e+00 | 99.7% |
| 412 | DQ480342 | Guignardia mangiferae isolate A4 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 630 | 97.7% | 1233.46 | 0.00e+00 | 99.7% |
| 413 | JQ743586 | Phyllosticta capitalensis strain CBS 123404 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 630 | 97.7% | 1233.46 | 0.00e+00 | 99.7% |
| 414 | OP872354 | Phyllosticta capitalensis strain CLW003 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 631 | 97.8% | 1233.46 | 0.00e+00 | 99.7% |
| 415 | MN635750 | Phyllosticta capitalensis isolate SM32 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 96.7% | 1221.57 | 0.00e+00 | 99.7% |
| 416 | MN319612 | Fungal sp. isolate 1122 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence. | 625 | 96.9% | 1221.57 | 0.00e+00 | 99.7% |
| 417 | MN635749 | Phyllosticta capitalensis isolate SM23 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1219.58 | 0.00e+00 | 99.7% |
| 418 | MF170677 | Phyllosticta capitalensis voucher CQYB-14 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1219.58 | 0.00e+00 | 99.7% |
| 419 | MK640597 | Guignardia sp. voucher HQU PL08 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1219.58 | 0.00e+00 | 99.7% |
| 420 | MN548090 | Phyllosticta capitalensis strain RiL-2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 623 | 96.6% | 1219.58 | 0.00e+00 | 99.7% |
| 421 | MK429845 | Botryosphaeria vaccinii isolate DZ-20 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1219.58 | 0.00e+00 | 99.7% |
| 422 | KX928710 | Uncultured fungus clone BY7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 96.7% | 1219.58 | 0.00e+00 | 99.7% |
| 423 | OP962337 | Phyllosticta capitalensis isolate KVKSAP-2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1219.58 | 0.00e+00 | 99.7% |
| 424 | JQ936158 | Guignardia vaccinii strain M110 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 623 | 96.6% | 1219.58 | 0.00e+00 | 99.7% |
| 425 | EU747725 | Guignardia mangiferae strain L2-2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 623 | 96.6% | 1219.58 | 0.00e+00 | 99.7% |
| 426 | MN548089 | Phyllosticta capitalensis strain RiL-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 623 | 96.6% | 1219.58 | 0.00e+00 | 99.7% |
| 427 | PV271801 | Phyllosticta capitalensis strain DNLP02 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1219.58 | 0.00e+00 | 99.7% |
| 428 | MN548091 | Phyllosticta capitalensis strain RiL-3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 623 | 96.6% | 1219.58 | 0.00e+00 | 99.7% |
| 429 | KC218454 | Guignardia sp. Fataf-10 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 622 | 96.4% | 1217.6 | 0.00e+00 | 99.7% |
| 430 | KP743020 | Phyllosticta capitalensis strain YZ5 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 622 | 96.4% | 1217.6 | 0.00e+00 | 99.7% |
| 431 | OQ683825 | Nigrospora sp. strain 12F small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1217.6 | 0.00e+00 | 99.7% |
| 432 | MN886954 | Phyllosticta capitalensis isolate CNUFC-RD74 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1217.6 | 0.00e+00 | 99.7% |
| 433 | MW063188 | Phyllosticta capitalensis isolate MFLUCC 19-0087 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1217.6 | 0.00e+00 | 99.7% |
| 434 | MN818617 | Phyllosticta capitalensis isolate JX-Y5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1217.6 | 0.00e+00 | 99.7% |
| 435 | JQ086349 | Guignardia camelliae strain B-15 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 622 | 96.4% | 1217.6 | 0.00e+00 | 99.7% |
| 436 | MN202719 | Phyllosticta capitalensis isolate OTU60 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 96.3% | 1215.62 | 0.00e+00 | 99.7% |
| 437 | MZ416907 | Phyllosticta capitalensis strain PD 016 06079565-2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 621 | 96.3% | 1215.62 | 0.00e+00 | 99.7% |
| 438 | GU066675 | Guignardia sp. 110MC/L 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region | 620 | 96.1% | 1213.64 | 0.00e+00 | 99.7% |
| 439 | EU677799 | Guignardia mangiferae isolate n3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 621 | 96.3% | 1213.64 | 0.00e+00 | 99.7% |
| 440 | OP133655 | Phyllosticta capitalensis strain QBKL9.3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 621 | 96.3% | 1213.64 | 0.00e+00 | 99.7% |
| 441 | AY277715 | Guignardia mangiferae strain CT_01 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 619 | 96.0% | 1211.65 | 0.00e+00 | 99.7% |
| 442 | AY277711 | Guignardia mangiferae strain 01_27 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 619 | 96.0% | 1211.65 | 0.00e+00 | 99.7% |
| 443 | KX631700 | Phyllosticta capitalensis strain HHL96 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 620 | 96.1% | 1211.65 | 0.00e+00 | 99.7% |
| 444 | MN871518 | Phyllosticta capitalensis strain KACC48906 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 620 | 96.1% | 1211.65 | 0.00e+00 | 99.7% |
| 445 | MK396601 | Phyllosticta capitalensis strain KACC48659 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 620 | 96.1% | 1211.65 | 0.00e+00 | 99.7% |
| 446 | FJ538332 | Guignardia mangiferae strain CBS 123374 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 618 | 95.8% | 1209.67 | 0.00e+00 | 99.7% |
| 447 | OP872375 | Phyllosticta capitalensis strain CLW275 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1207.69 | 0.00e+00 | 99.7% |
| 448 | KF128851 | Guignardia sp. GSM5_5_10 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 618 | 95.8% | 1207.69 | 0.00e+00 | 99.7% |
| 449 | OP872398 | Phyllosticta capitalensis strain CLW006 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence | 617 | 95.7% | 1207.69 | 0.00e+00 | 99.7% |
| 450 | FJ538347 | Guignardia mangiferae strain CMU 139 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 618 | 95.8% | 1207.69 | 0.00e+00 | 99.7% |
| 451 | KT900578 | Phyllosticta capitalensis isolate F2 28S ribosomal RNA gene, partial sequence | 616 | 95.5% | 1205.71 | 0.00e+00 | 99.7% |
| 452 | KP998485 | Phyllosticta capitalensis 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 616 | 95.5% | 1205.71 | 0.00e+00 | 99.7% |
| 453 | OR365749 | Phyllosticta elongata isolate 2L2B small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1261.21 | 0.00e+00 | 99.5% |
| 454 | MZ343514 | Phyllosticta sp. isolate I5L1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1259.23 | 0.00e+00 | 99.5% |
| 455 | MZ343523 | Phyllosticta sp. isolate I6L1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1259.23 | 0.00e+00 | 99.5% |
| 456 | MT186148 | Phyllosticta capitalensis isolate MFE21 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1257.25 | 0.00e+00 | 99.5% |
| 457 | MT186147 | Phyllosticta capitalensis isolate MFE20 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1257.25 | 0.00e+00 | 99.5% |
| 458 | MT186142 | Phyllosticta capitalensis isolate MFE6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1257.25 | 0.00e+00 | 99.5% |
| 459 | HM537060 | Fungal endophyte sp. g83 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1255.26 | 0.00e+00 | 99.5% |
| 460 | KC686598 | Guignardia mangiferae isolate MFUCC120015 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1255.26 | 0.00e+00 | 99.5% |
| 461 | MZ343548 | Phyllosticta sp. isolate I8T1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1255.26 | 0.00e+00 | 99.5% |
| 462 | OP872373 | Phyllosticta capitalensis strain CLW280 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1253.28 | 0.00e+00 | 99.5% |
| 463 | OP872396 | Phyllosticta capitalensis strain CLW072 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1253.28 | 0.00e+00 | 99.5% |
| 464 | OP872376 | Phyllosticta capitalensis strain CLW283 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1253.28 | 0.00e+00 | 99.5% |
| 465 | OP872374 | Phyllosticta capitalensis strain CLW271 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1251.3 | 0.00e+00 | 99.5% |
| 466 | OP872382 | Phyllosticta capitalensis strain CLW316 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1251.3 | 0.00e+00 | 99.5% |
| 467 | OP872379 | Phyllosticta capitalensis strain CLW301 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1251.3 | 0.00e+00 | 99.5% |
| 468 | OP872402 | Phyllosticta capitalensis strain CLW393 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 644 | 99.8% | 1251.3 | 0.00e+00 | 99.5% |
| 469 | KF955290 | Guignardia mangiferae strain GZAAS6.1201 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 642 | 99.5% | 1249.32 | 0.00e+00 | 99.5% |
| 470 | OP872381 | Phyllosticta capitalensis strain CLW314 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1247.34 | 0.00e+00 | 99.5% |
| 471 | KR056283 | Phyllosticta capitalensis strain M111 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 640 | 99.2% | 1247.34 | 0.00e+00 | 99.5% |
| 472 | OP872394 | Phyllosticta capitalensis strain CLW124 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1247.34 | 0.00e+00 | 99.5% |
| 473 | OP872377 | Phyllosticta capitalensis strain CLW286 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 642 | 99.5% | 1247.34 | 0.00e+00 | 99.5% |
| 474 | PP946770 | Phyllosticta capitalensis isolate SDBR-CMU497 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1235.44 | 0.00e+00 | 99.5% |
| 475 | OQ172285 | Phyllosticta capitalensis isolate CATAS-FSJ17 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 634 | 98.3% | 1231.48 | 0.00e+00 | 99.5% |
| 476 | EU677809 | Guignardia mangiferae isolate xhy-02 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 624 | 96.7% | 1213.64 | 0.00e+00 | 99.5% |
| 477 | EU747726 | Guignardia mangiferae strain L2-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 623 | 96.6% | 1213.64 | 0.00e+00 | 99.5% |
| 478 | EU677816 | Guignardia mangiferae isolate ymy-01 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 624 | 96.7% | 1213.64 | 0.00e+00 | 99.5% |
| 479 | OR770585 | Phyllosticta fallopiae isolate SPK 5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 96.7% | 1213.64 | 0.00e+00 | 99.5% |
| 480 | OQ271296 | Phyllosticta fallopiae strain KACC410236 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 96.7% | 1211.65 | 0.00e+00 | 99.5% |
| 481 | PQ774968 | Phyllosticta fallopiae strain SZSS 4-1-2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1211.65 | 0.00e+00 | 99.5% |
| 482 | EU677817 | Guignardia mangiferae isolate ymy-02 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 623 | 96.6% | 1211.65 | 0.00e+00 | 99.5% |
| 483 | PV271802 | Phyllosticta capitalensis strain DNLP03 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1211.65 | 0.00e+00 | 99.5% |
| 484 | ON012913 | Phyllosticta capitalensis strain C small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 96.7% | 1211.65 | 0.00e+00 | 99.5% |
| 485 | KC816052 | Guignardia mangiferae strain m110801-4-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 622 | 96.4% | 1209.67 | 0.00e+00 | 99.5% |
| 486 | GQ352474 | Guignardia sp. 3GP/L 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 621 | 96.3% | 1207.69 | 0.00e+00 | 99.5% |
| 487 | MW412579 | Phyllosticta capitalensis isolate CATAS-PC04 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 622 | 96.4% | 1207.69 | 0.00e+00 | 99.5% |
| 488 | MZ710154 | Phyllosticta capitalensis isolate SLF6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 620 | 96.1% | 1205.71 | 0.00e+00 | 99.5% |
| 489 | MT186143 | Phyllosticta capitalensis isolate MFE10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1249.32 | 0.00e+00 | 99.4% |
| 490 | KF128835 | Guignardia sp. GSL5_5_1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 626 | 97.1% | 1207.69 | 0.00e+00 | 99.4% |
| 491 | MF800912 | Phyllosticta capitalensis isolate 10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1205.71 | 0.00e+00 | 99.4% |
| 492 | MN635752 | Phyllosticta capitalensis isolate SM48 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 96.7% | 1205.71 | 0.00e+00 | 99.4% |
| 493 | ON014497 | Phyllosticta capitalensis strain H small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 624 | 96.7% | 1203.73 | 0.00e+00 | 99.4% |
| 494 | MN635753 | Phyllosticta capitalensis isolate SM53 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 623 | 96.6% | 1203.73 | 0.00e+00 | 99.4% |
| 495 | LC040896 | Phyllosticta capitalensis genes for 18S rRNA, ITS1, 5,8S rRNA, ITS2, 28S rRNA, partial and complete sequence, strain: M35 | 643 | 99.7% | 1237.42 | 0.00e+00 | 99.2% |
| 496 | MK120855 | Phyllosticta sp. strain Eef-2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1225.53 | 0.00e+00 | 98.9% |
| 497 | AB179772 | Phyllosticta sp. TACP00K40104 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence | 645 | 100.0% | 1219.58 | 0.00e+00 | 98.9% |
| 498 | AB179771 | Phyllosticta sp. TACP00K4021 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence | 645 | 100.0% | 1217.6 | 0.00e+00 | 98.9% |
| 499 | OK021605 | Botryosphaeria vaccinii isolate FC6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence | 645 | 100.0% | 1223.55 | 0.00e+00 | 98.8% |
| 500 | JQ936157 | Guignardia vaccinii strain M41 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence | 645 | 100.0% | 1207.69 | 0.00e+00 | 98.5% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the distribution of BLAST hits identity within each genus. Each data point shows the alignment identity between the query sequence and reference sequence. The analyst may wish to refer to this figure when making a subjective genus-level identification for the sample.
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage |
|---|---|---|---|---|---|---|
| Fungi | kingdom | Fungi | Phyllosticta capitalensis | OP897171 | 1.0 |
Database coverage of Taxon of Interest FungiThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis. |
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |